86
|
Eurofins
ccttcaactcctcaagatctacttgcc eurofins scientific n a primer Ccttcaactcctcaagatctacttgcc Eurofins Scientific N A Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ccttcaactcctcaagatctacttgcc eurofins scientific n a primer/product/Eurofins Average 86 stars, based on 1 article reviews
ccttcaactcctcaagatctacttgcc eurofins scientific n a primer - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
90
|
Shanghai GenePharma
probes and rna in situ hybridization kit Probes And Rna In Situ Hybridization Kit, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/probes and rna in situ hybridization kit/product/Shanghai GenePharma Average 90 stars, based on 1 article reviews
probes and rna in situ hybridization kit - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Ribobio co
lncrna fish probe and fluorescent in situ hybridization kit Lncrna Fish Probe And Fluorescent In Situ Hybridization Kit, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lncrna fish probe and fluorescent in situ hybridization kit/product/Ribobio co Average 90 stars, based on 1 article reviews
lncrna fish probe and fluorescent in situ hybridization kit - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
TIB MOLBIOL
sequence-specific hybridization probes Sequence Specific Hybridization Probes, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequence-specific hybridization probes/product/TIB MOLBIOL Average 90 stars, based on 1 article reviews
sequence-specific hybridization probes - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
ZytoVision gmbh
zytolight rat y/12 fluorescence in situ hybridization (fish) y- chromosome probe Zytolight Rat Y/12 Fluorescence In Situ Hybridization (Fish) Y Chromosome Probe, supplied by ZytoVision gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/zytolight rat y/12 fluorescence in situ hybridization (fish) y- chromosome probe/product/ZytoVision gmbh Average 90 stars, based on 1 article reviews
zytolight rat y/12 fluorescence in situ hybridization (fish) y- chromosome probe - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
BlueGnome Limited
fluorescent in situ hybridization probes Fluorescent In Situ Hybridization Probes, supplied by BlueGnome Limited, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/fluorescent in situ hybridization probes/product/BlueGnome Limited Average 90 stars, based on 1 article reviews
fluorescent in situ hybridization probes - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Ribobio co
sirna targeting human lncrna snhg8 Sirna Targeting Human Lncrna Snhg8, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sirna targeting human lncrna snhg8/product/Ribobio co Average 90 stars, based on 1 article reviews
sirna targeting human lncrna snhg8 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
ZytoVision gmbh
syt dual color break apart probe-based fluorescence in situ hybridization (fish) test z-2097-50 Syt Dual Color Break Apart Probe Based Fluorescence In Situ Hybridization (Fish) Test Z 2097 50, supplied by ZytoVision gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/syt dual color break apart probe-based fluorescence in situ hybridization (fish) test z-2097-50/product/ZytoVision gmbh Average 90 stars, based on 1 article reviews
syt dual color break apart probe-based fluorescence in situ hybridization (fish) test z-2097-50 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
sequence-specific hybridization probes (0.3 µm per reaction) 5′- aggatacg aatgtgcagctgac -fl Sequence Specific Hybridization Probes (0.3 µm Per Reaction) 5′ Aggatacg Aatgtgcagctgac Fl, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequence-specific hybridization probes (0.3 µm per reaction) 5′- aggatacg aatgtgcagctgac -fl/product/Metabion International AG Average 90 stars, based on 1 article reviews
sequence-specific hybridization probes (0.3 µm per reaction) 5′- aggatacg aatgtgcagctgac -fl - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Ribobio co
a fluorescence in situ hybridization kit and probes A Fluorescence In Situ Hybridization Kit And Probes, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/a fluorescence in situ hybridization kit and probes/product/Ribobio co Average 90 stars, based on 1 article reviews
a fluorescence in situ hybridization kit and probes - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
EXONBIO Inc
mirna in situ hybridization probes specific for human mir-548a-3p Mirna In Situ Hybridization Probes Specific For Human Mir 548a 3p, supplied by EXONBIO Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mirna in situ hybridization probes specific for human mir-548a-3p/product/EXONBIO Inc Average 90 stars, based on 1 article reviews
mirna in situ hybridization probes specific for human mir-548a-3p - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
ImmunoMAX Co Ltd
in situ hybridization probes dna 16 In Situ Hybridization Probes Dna 16, supplied by ImmunoMAX Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/in situ hybridization probes dna 16/product/ImmunoMAX Co Ltd Average 90 stars, based on 1 article reviews
in situ hybridization probes dna 16 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |